RHESUS-VUVQCHMK2
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGLV5-57*01: a Macaca mulatta IGL V allele sequence, 309 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / V |
| Functional i | False |
| Length | 309 nt |
| Protein UID i | RHESUS-VP-7JBY7U (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: formerly IGLV5-15*01 (to 2016-12-19);
Allele names i
Every name below denotes this exact sequence (RHESUS-VUVQCHMK2). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV19-GNF7*01 | IgLabel | MUSA, OGRDB |
| IGLV5-57*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| BK063717.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGLV5-15*01 | 2016-12-19 |
External records i
NCBI nucleotide: link GenBank: GENBANK:BK063717 GenBank: GENBANK:BK063717.1 IMGT: IGLV5-57*01 OGRDB: IGLV19-GNF7*01
Literature references i
PubMed publications linked to this allele.
Contributed by IMGT, MUSA, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGACACACACAGATGGGGAGGTGAGACAAAAACA | IMGT MUSA | RHESUS-RTHK6I |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| TTGGCCTGGACTCCTCTCCTCCTCTTGCTCCTCTCTCACTGCACAGGTTCCCTCTCC | 46 + 11 nt | IMGT | RHESUS-LMOKKK |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VUVQCHMK2/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases