RHESUS-VXDQV4LU3
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV2-ZBTP*01_c2a_g4a_t5c_c43a_a47g_g51a_t55g_a56g_g68t_a72g_t125a_g135t_g202a_a204c_g220a_t231g_g233a_g250a_t254c_a257c_c265t_t294c_c303t_t331c: a Macaca mulatta IGK V allele sequence, 302 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 302 nt |
| Protein UID i | RHESUS-VP-6GTBRI (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VXDQV4LU3). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV0-3QEK*02 | IgLabel | OGRDB |
| IGKV2-ZBTP*01_c2a_g4a_t5c_c43a_a47g_g51a_t55g_a56g_g68t_a72g_t125a_g135t_g202a_a204c_g220a_t231g_g233a_g250a_t254c_a257c_c265t_t294c_c303t_t331c | VDJbase | MUSA |
External records i
OGRDB: IGKV0-3QEK*02
Contributed by MUSA, OGRDB. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAATGGTACAGTCCTGAACCCAAACC | MUSA | RHESUS-RQSMVN |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VXDQV4LU3/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases