RHESUS-VZ4WLDL2S
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGLV2-26*02, IGLV2-ADK*01: a Macaca mulatta IGL V allele sequence, 297 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / V |
| Functional i | True |
| Length | 297 nt |
| Protein UID i | RHESUS-VP-KELBFE (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: formerly IGLV2-5*01 (to 2019-03-01);
Allele names i
Every name below denotes this exact sequence (RHESUS-VZ4WLDL2S). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGLV2-26*02, IGLV2-ADK*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV2-4HKX*02 | IgLabel | MUSA |
| IGLV2-M5CD*03 | IgLabel | OGRDB |
| IGLV2-26*02 | IMGT | IMGT |
| IGLV2-ADK*01 | RhGLDB+ | RhGLDB+ |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| NW_001095158.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGLV2-5*01 | 2019-03-01 |
External records i
genbank:MF989453: GENBANK:MF989453 genbank:IMGT000062: GENBANK:IMGT000062 NCBI nucleotide: link GenBank: GENBANK:NW_001095158 IMGT: IGLV2-26*02 OGRDB: IGLV2-M5CD*03
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29163486 | verified | MUSA | |
| 31080066 | verified | MUSA | |
| 32866207 | Mapping the immunogenic landscape of near-native HIV-1 envelope trimers in non-human primates. | sequence in paper | literature_supp |
| 39068149 | Multi-compartmental diversification of neutralizing antibody lineages dissected in SARS-CoV-2 spike-immunized macaques. | sequence in paper | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 37076511 | Vaccination of SARS-CoV-2-infected individuals expands a broad range of clonally diverse affinity-matured B cell lineages. | name mentioned* | literature_supp |
| 38042809 | Interaction dynamics between innate and adaptive immune cells responding to SARS-CoV-2 vaccination in non-human primates. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, MUSA, OGRDB, RhGLDB+, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGGTCCAATTTCATGAGGAACTGAGACCAAAACC | IMGT MUSA | RHESUS-RSGRHC |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGCCTGGGCTCTGCTCCTCCTCACCCTTCTCACTCAAGGCACAGGATCCTGGGCT | 46 + 11 nt | IMGT | RHESUS-LOZTBP |
| ATGGCCTGGGCTCTGCTCCTCCTCACCCTTCTCACTCAAGGCACAGGCGATCCTGGGCT | 48 + 11 nt | MUSA | RHESUS-LXNGT6 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VZ4WLDL2S/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases