RHESUS-VZAZ4S2V5
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV3-49*05: a Macaca mulatta IGH V allele sequence, 292 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 292 nt |
| Protein UID i | RHESUS-VP-NM55EV (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VZAZ4S2V5). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-49*05 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AM940221.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link IMGT: IGHV3-49*05
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 31974198 | Genomic arrays identify high-risk chronic lymphocytic leukemia with genomic complexity: a multi-center study. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 33717051 | Poorly Expressed Alleles of Several Human Immunoglobulin Heavy Chain Variable Genes are Common in the Human Population. | name mentioned* | literature_supp |
| 33843586 | Distinct clonal evolution of B-cells in HIV controllers with neutralizing antibody breadth. | name mentioned* | literature_supp |
| 34126625 | Naturally enhanced neutralizing breadth against SARS-CoV-2 one year after infection. | name mentioned* | literature_supp |
| 34614412 | mRNA vaccination of naive and COVID-19-recovered individuals elicits potent memory B cells that recognize SARS-CoV-2 variants. | name mentioned* | literature_supp |
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | name mentioned* | literature_supp |
| 34785098 | Landscapes and dynamic diversifications of B-cell receptor repertoires in COVID-19 patients. | name mentioned* | literature_supp |
| 35776090 | Antibody evolution to SARS-CoV-2 after single-dose Ad26.COV2.S vaccine in humans. | name mentioned* | literature_supp |
| 36149398 | Memory B cell responses to Omicron subvariants after SARS-CoV-2 mRNA breakthrough infection in humans. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36353774 | High activation levels maintained in receptor-binding domain-specific memory B cells in people with severe coronavirus disease 2019. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 37076511 | Vaccination of SARS-CoV-2-infected individuals expands a broad range of clonally diverse affinity-matured B cell lineages. | name mentioned* | literature_supp |
| 37114042 | Adaptive immune receptor genotyping using the corecount program. | name mentioned* | literature_supp |
| 37368240 | Memory B cell development elicited by mRNA booster vaccinations in the elderly. | name mentioned* | literature_supp |
| 38643233 | An ancestral SARS-CoV-2 vaccine induces anti-Omicron variants antibodies by hypermutation. | name mentioned* | literature_supp |
| 39840032 | An allelic atlas of immunoglobulin heavy chain variable regions reveals antibody binding epitope preference resilient to SARS-CoV-2 mutation escape. | name mentioned* | literature_supp |
| 41606257 | Allergen-specific human IgE isolated through an allergen-agnostic pipeline-understanding immune response and allergen recognition. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CAGTGCAGGGAAGTCAGGGTAAGCCCAGACACAAACC | IMGT | RHESUS-R7BJNX |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGGGTTTGGGCTGACCTGGGATTTACTTATTACTATTTTAAAAGTGGTCGTCTAGTGT | 49 + 11 nt | IMGT | RHESUS-LPC6DS |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VZAZ4S2V5/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases