SALMON-VISMM7AM6
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV6-22*01: a Salmo salar IGH V allele sequence, 75 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Salmo salar (NCBITAXON:8030) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 75 nt |
| Protein UID i | SALMON-VP-EYM6UZ (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (SALMON-VISMM7AM6). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV6-22*01 | IMGT | IMGT |
External records i
IMGT: IGHV6-22*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGTTCCCTGCATCTCTGCTGCAGCTTTCTCCTGTGAGTCTCTCTGGTATTTAC | 46 + 8 nt | IMGT | SALMON-LBO56M |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/SALMON-VISMM7AM6/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases