SALMON-VM4KPUBPI
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV4-4*01: a Salmo salar IGH V allele sequence, 289 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Salmo salar (NCBITAXON:8030) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 289 nt |
| Protein UID i | SALMON-VP-I4QEBH (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (SALMON-VM4KPUBPI). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV4-4*01 | IMGT | IMGT |
External records i
IMGT: IGHV4-4*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 19563687 | Isolation of a human-like antibody fragment (scFv) that neutralizes ricin biological activity. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 33095260 | Longevity, clonal relationship, and transcriptional program of celiac disease-specific plasma cells. | name mentioned* | literature_supp |
| 33717051 | Poorly Expressed Alleles of Several Human Immunoglobulin Heavy Chain Variable Genes are Common in the Human Population. | name mentioned* | literature_supp |
| 34175903 | Immunoglobulin germline gene variation and its impact on human disease. | name mentioned* | literature_supp |
| 34667305 | Commentary on Population matched (pm) germline allelic variants of immunoglobulin (IG) loci: relevance in infectious diseases and vaccination studies in human populations. | name mentioned* | literature_supp |
| 34671351 | Computational Inference, Validation, and Analysis of 5'UTR-Leader Sequences of Alleles of Immunoglobulin Heavy Chain Variable Genes. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 37291228 | B cell profiles, antibody repertoire and reactivity reveal dysregulated responses with autoimmune features in melanoma. | name mentioned* | literature_supp |
| 38406579 | AIRR-C IG Reference Sets: curated sets of immunoglobulin heavy and light chain germline genes. | name mentioned* | literature_supp |
| 39489605 | An unbiased comparison of immunoglobulin sequence aligners. | name mentioned* | literature_supp |
| 39840032 | An allelic atlas of immunoglobulin heavy chain variable regions reveals antibody binding epitope preference resilient to SARS-CoV-2 mutation escape. | name mentioned* | literature_supp |
| 40066131 | Characterization of Immunoglobulin Heavy Locus Rearrangements in Molecular Subtypes of Childhood B-Cell Precursor Acute Lymphoblastic Leukemia. | name mentioned* | literature_supp |
| 40118521 | De novo antibody identification in human blood from full-length single B cell transcriptomics and matching haplotype-resolved germline assemblies. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACACTGACTGAAGCTGGTGAAGCAGCTGTACAAAACCC | IMGT | SALMON-RE6PFR |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGACTGTCTGTAGTCTAGTTCTCATGGTGATGTCCATACACATTAAGTGCTTGC | 47 + 8 nt | IMGT | SALMON-LXIMR2 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/SALMON-VM4KPUBPI/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases