SALMON-VMIQWKSRD
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV5D-131*01: a Salmo salar IGH V allele sequence, 286 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| SALMON-V5KXJCOQK | IGHV5D-131*01 | 287 nt | contains this record | 2018-09-27–2019-03-01 |
| Species | Salmo salar (NCBITAXON:8030) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 286 nt |
| Protein UID i | SALMON-VP-CQGPOP (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: re-cut from IGHV5D-131*01 (287 nt);
Allele names i
Every name below denotes this exact sequence (SALMON-VMIQWKSRD). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV5D-131*01 | IMGT | IMGT |
External records i
IMGT: IGHV5D-131*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTTGTGTGAAGCAAAGCATGACCTGTACAAAAACA | IMGT | SALMON-RTCDHE |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGTTCCCGCATCTCTGCTGCTGCTGCTGGCAGCTGCCTCCTCATGGTATTGTT | 42 + 12 nt | IMGT | SALMON-LC75IV |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/SALMON-VMIQWKSRD/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases