SHEEP-J5SXTDTUL
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRAJ6*01: a Ovis aries TRA J allele sequence, 62 nt, not recorded. The nucleotide sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| SHEEP-JR4YL5HEM | TRAJ6*01 | 63 nt | contains this record | 2016-12-19–2020-01-31 |
| Species | Ovis aries (NCBITAXON:9940) |
|---|---|
| Locus / type | TRA / J |
| Functional i | None |
| Length | 62 nt |
Coding sequence (nt)
Name history i: re-cut from TRAJ6*01 (63 nt);
Allele names i
Every name below denotes this exact sequence (SHEEP-J5SXTDTUL). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRAJ6*01 | IMGT | IMGT |
External records i
IMGT: TRAJ6*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| j_rs | GGTTTTAGCAAGGGCTTTCCTTGCTGTG | IMGT | SHEEP-R5A6I4 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/SHEEP-J5SXTDTUL/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases