TROUT-JFSVK6C7A
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHJ4*01, IGHJ6D*02: a Oncorhynchus mykiss IGH J allele sequence, 51 nt, functional. The nucleotide sequence is below, with every recorded name and its source.
| Species | Oncorhynchus mykiss (NCBITAXON:8022) |
|---|---|
| Locus / type | IGH / J |
| Functional i | True |
| Length | 51 nt |
Coding sequence (nt)
Name history i: formerly IGHJ6*01 (to 2015-03-19);
Allele names i
Every name below denotes this exact sequence (TROUT-JFSVK6C7A). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGHJ4*01, IGHJ6D*02. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHJ4*01 | IMGT | IMGT |
| IGHJ6D*02 | IMGT | IMGT |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGHJ6*01 | 2015-03-19 |
External records i
IMGT: IGHJ4*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| j_rs | GGTTTTTGTGCATAGCCTGTATTGGTTATTTGCACTGTG | IMGT | TROUT-RXRXKC |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/TROUT-JFSVK6C7A/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases