Leader RHESUS-L6IIUU
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (57 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
57 nt
ATGAGGAGCGTGCTCTGAGGGGGCTTATTCTTCAGTGAAAGGACCTCTGCCCACTCC
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV1-TCEU*02_c6g_c21t_a38g_g46-_a60g_c61g_c69t_g72t_g73t_c74t_t81g_a83t_c86t_t88a_t90c_c105a_t112a_a113g_a118c_t125c_a127c_t146g_g151a_t167a_t168c_t192c_c194g_g197t_g202a_a204g_c213t_c214a_g224c_g226c_c230a_c231t_c251a_t255c_a265g_t266c_c271t_307--------------320 | RHESUS | IGH | MUSA | RHESUS-V5UCCKHIJ |