Leader RHESUS-LK4CBR
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (63 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (17 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
63 nt
ATGGGATCCAGGCAGGAAAACAGCTTCCTTTACAAAGTGGTTGGGCAGCCCTCCTTCCATGGG
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV3-N72G*01_g3c_g4t_g6c_c7g_g9c_c10g_t11a_a15t_a17g_g18a_t21g_23ttctt27_g31t_c33a_t34c_t35g_g37a_39agtat43_t45c_g46c_49aaact53_57ctccactc64_t69c_c71t_a73t_t76c_c77g_t78g_a81t_t82c_a85t_c87a_t88g_c90g_104caagtg109_a115g_t116g_g118a_a119g_c127t_a138-_a142g_a163g_c172a_a174t_g182c_g191a_c194g_a197g_g216c_c223t_a245g_c281t_g289a_a297g_300------------ca313_a316t | RHESUS | IGH | MUSA | RHESUS-VPE3YZ2IC |