Leader RHESUS-LSG6BP
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (63 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (17 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
63 nt
ATGGAGTTGGGGCTGCACTGGGTTTCGTCGTTCTAAAAGGTGACTCTGCAGCTGGTGTAGTCT
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV3-6HY2*01_a2g_5gaggct10_t14c_g15a_g16c_g18t_t19c_a27t_g31c_g32c_t35g_g36a_t38a_c40t_a41c_g42t_g46-_g48t_c55t_t56c_g57a_c75t_t83c_c111t_t112g_g114c_t118c_a119g_g122a_c126g_g132a_g147a_c148t_g153a_t158g_g164-_t165-_g170a_a172c_g173c_g175a_a176c_g186t_a187g_t189a_a190g_a196t_g197a_g202c_g216a_g243a_g247a_g273a_g284a_g289a_a291c_g303c_t310a_a317g | RHESUS | IGH | MUSA | RHESUS-VAXOPOBAW |