Leader RHESUS-LUYS24
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (57 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
57 nt
ATGGAGTTTGGTCTCAGCTGGGTTTTCCTTATTGCTACTTTAAAGAGTGTCCAGTGT
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV3-6HY2*02_g3c_g4a_g22t_g23t_g31a_g37t_a39g_c40t_g50c_g51a_c55g_c63t_t67c_g68t_c90t_a103t_c108g_t118a_a119g_g128a_g144a_g155a_c163t_g164t_a166t_t168g_g175a_a176g_g186a_a187g_t189c_c201t_a204g_c210t_c222t_g224c_g243t_a244g_c246t_c255a_g267a_a271g_t279c_t280c_c294t_c296g_a297t_g301a_307--------------320 | RHESUS | IGH | MUSA | RHESUS-V5WDFWDVT |