Leader RHESUS-LWFZFZ
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (63 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (17 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
63 nt
ATGGGACAGCCTCTGGGCTGCACATGAGGAGGGCTCCCTCCCCACGTTCCATGGGAACGTCAA
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV3-7FPK*01_i0c_6tgga9_t11c_15tctt18_c20g_t21a_g22t_g25a_g26t_32--------t40_g42t_t45c_g46c_g47c_g49a_g50a_g51c_54ttctcc59_t64-_t69c_c71t_g73t_t76c_t78g_a81t_t82c_a85t_c87a_t88g_c90g_104caagtg109_a115g_t116g_g118a_a119g_c127t_i137gg_a138g_a142g_a143g_a163g_i170taa_g172c_g173c_g176c_c177t_a184g_c194g_a197g_g216c_c223t_c237-_a238-_a245g_g289a_t296c_300------------ca313_a316t | RHESUS | IGH | MUSA | RHESUS-VLBIKZH3E |