RSS RHESUS-R65FP7
| Species | RHESUS |
|---|---|
| Type | 5'D-RS · complete signal, 5' of D (28 nt) |
| Sources | MUSA |
Heptamer
Spacer (12 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
28 nt
AGTTTTCCCTGAGTTCAGGCATGCACTG
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHD9-GADR*01_i0tccctgaactttcattt_a3c_a4c_g6c_c8g_a10t_a12g_g16c_g20c_t21a_a23c_c24t_g27c_t28a | RHESUS | IGH | MUSA | RHESUS-DHAKAK2PC |