RSS RHESUS-R6UWWX
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (28 nt) |
| Sources | MUSA |
Heptamer
Spacer (12 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
28 nt
AACAGTGCTACATCCTGGAACAGAAACC
Find similar RSS
Alleles with this RSS variant
3 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGKV2-RQVU*01_t8c_c20t_t36c_c75t_c88t_c114t_t162c_c222g_c308a_336cc337 | RHESUS | IGK | MUSA | RHESUS-V7FTFXA2P |
| IGKV2-CGHM*01_g37a_a54g_a103g_a330g_337ccccc341 | RHESUS | IGK | MUSA | RHESUS-VKUJ7OWTJ |
| IGKV2-CGHM*01_a54g_a103g_a330g_c331t_337ccc339 | RHESUS | IGK | MUSA | RHESUS-VG2F5GWXX |