HUMAN-VCI3T5SC2
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGH / V |
| Functional i | False |
| Length | 296 nt |
| Protein UID i | HUMAN-VP-QY46UQ (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (HUMAN-VCI3T5SC2). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-25*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| M99661.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:M99661 GenBank: GENBANK:M99661.1 IMGT: IGHV3-25*01
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 8490662 | verified | ncbi_nucleotide | |
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | sequence in paper | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 34484220 | RAPID: A Rep-Seq Dataset Analysis Platform With an Integrated Antibody Database. | name mentioned* | literature_supp |
| 35545447 | Gene prediction in the immunoglobulin loci. | name mentioned* | literature_supp |
| 38961347 | Systematic characterization of immunoglobulin loci and deep sequencing of the expressed repertoire in the Atlantic cod (Gadus morhua). | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACC | IMGT | HUMAN-R6AAZB |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGAGTTTGTGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAACGTATCCAGTGT | 46 + 11 nt | IMGT | HUMAN-LXNSY2 |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VCI3T5SC2/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases