HUMAN-VJ4ROGN32
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 296 nt |
| Protein UID i | HUMAN-VP-5DW4VN (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (HUMAN-VJ4ROGN32). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-3KMZ*03 | IgLabel | HUSA |
| IGHV3-7*01 | IMGT | IMGT, KIARVA, OGRDB |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| M99649.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:M99649 GenBank: GENBANK:M99649.1 IMGT: IGHV3-7*01 OGRDB: IGHV3-7*01
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 8490662 | verified | ncbi_nucleotide | |
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | sequence in paper | literature_supp |
| 36353774 | High activation levels maintained in receptor-binding domain-specific memory B cells in people with severe coronavirus disease 2019. | sequence in paper | literature_supp |
| 37076511 | Vaccination of SARS-CoV-2-infected individuals expands a broad range of clonally diverse affinity-matured B cell lineages. | sequence in paper | literature_supp |
| 37114042 | Adaptive immune receptor genotyping using the corecount program. | sequence in paper | literature_supp |
| 38643233 | An ancestral SARS-CoV-2 vaccine induces anti-Omicron variants antibodies by hypermutation. | sequence in paper | literature_supp |
| 26608341 | Longitudinal analysis of the peripheral B cell repertoire reveals unique effects of immunization with a new influenza virus strain. | name mentioned* | literature_supp |
| 28604797 | A human inferred germline antibody binds to an immunodominant epitope and neutralizes Zika virus. | name mentioned* | literature_supp |
| 28643244 | Durvalumab: First Global Approval. | name mentioned* | literature_supp |
| 29180996 | Antibody Heavy Chain Variable Domains of Different Germline Gene Origins Diversify through Different Paths. | name mentioned* | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 29662487 | Acquisition of N-Glycosylation Sites in Immunoglobulin Heavy Chain Genes During Local Expansion in Parotid Salivary Glands of Primary Sjögren Patients. | name mentioned* | literature_supp |
| 30530648 | Virus-inclusive single-cell RNA sequencing reveals the molecular signature of progression to severe dengue. | name mentioned* | literature_supp |
| 30697215 | VH1-69 Utilizing Antibodies Are Capable of Mediating Non-neutralizing Fc-Mediated Effector Functions Against the Transmitted/Founder gp120. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 31974198 | Genomic arrays identify high-risk chronic lymphocytic leukemia with genomic complexity: a multi-center study. | name mentioned* | literature_supp |
| 32425948 | AID Overlapping and Polη Hotspots Are Key Features of Evolutionary Variation Within the Human Antibody Heavy Chain (IGHV) Genes. | name mentioned* | literature_supp |
| 32636395 | IgCaller for reconstructing immunoglobulin gene rearrangements and oncogenic translocations from whole-genome sequencing in lymphoid neoplasms. | name mentioned* | literature_supp |
| 32668194 | Next-Generation Sequencing of T and B Cell Receptor Repertoires from COVID-19 Patients Showed Signatures Associated with Severity of Disease. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 33458528 | Human Hexa-Histidine-Tagged Single-Chain Variable Fragments for Bioimaging of Bacterial Infections. | name mentioned* | literature_supp |
| 33485405 | Enhancement versus neutralization by SARS-CoV-2 antibodies from a convalescent donor associates with distinct epitopes on the RBD. | name mentioned* | literature_supp |
| 33843586 | Distinct clonal evolution of B-cells in HIV controllers with neutralizing antibody breadth. | name mentioned* | literature_supp |
| 34040612 | Characterization of DNA G-Quadruplex Structures in Human Immunoglobulin Heavy Variable (IGHV) Genes. | name mentioned* | literature_supp |
| 34104872 | Potent germline-like monoclonal antibodies: rapid identification of promising candidates for antibody-based antiviral therapy. | name mentioned* | literature_supp |
| 34120151 | Population matched (pm) germline allelic variants of immunoglobulin (IG) loci: Relevance in infectious diseases and vaccination studies in human populations. | name mentioned* | literature_supp |
| 34126625 | Naturally enhanced neutralizing breadth against SARS-CoV-2 one year after infection. | name mentioned* | literature_supp |
| 34242577 | In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. | name mentioned* | literature_supp |
| 34484220 | RAPID: A Rep-Seq Dataset Analysis Platform With an Integrated Antibody Database. | name mentioned* | literature_supp |
| 34614412 | mRNA vaccination of naive and COVID-19-recovered individuals elicits potent memory B cells that recognize SARS-CoV-2 variants. | name mentioned* | literature_supp |
| 34707037 | t(9;14)(p13;q32)/PAX5-IGH translocation as a secondary cytogenetic abnormality in diffuse large B-cell lymphoma. | name mentioned* | literature_supp |
| 34765543 | The Hydropathy Index of the HCDR3 Region of the B-Cell Receptor Identifies Two Subgroups of IGHV-Mutated Chronic Lymphocytic Leukemia Patients With Distinct Outcome. | name mentioned* | literature_supp |
| 34770845 | Engineered Fully Human Single-Chain Monoclonal Antibodies to PIM2 Kinase. | name mentioned* | literature_supp |
| 34785098 | Landscapes and dynamic diversifications of B-cell receptor repertoires in COVID-19 patients. | name mentioned* | literature_supp |
| 35108220 | Ultrapotent neutralizing antibodies against SARS-CoV-2 with a high degree of mutation resistance. | name mentioned* | literature_supp |
| 35397794 | A large-scale systematic survey reveals recurring molecular features of public antibody responses to SARS-CoV-2. | name mentioned* | literature_supp |
| 35447092 | Analysis of memory B cells identifies conserved neutralizing epitopes on the N-terminal domain of variant SARS-Cov-2 spike proteins. | name mentioned* | literature_supp |
| 35545447 | Gene prediction in the immunoglobulin loci. | name mentioned* | literature_supp |
| 35592326 | Pandemic, Epidemic, Endemic: B Cell Repertoire Analysis Reveals Unique Anti-Viral Responses to SARS-CoV-2, Ebola and Respiratory Syncytial Virus. | name mentioned* | literature_supp |
| 35776090 | Antibody evolution to SARS-CoV-2 after single-dose Ad26.COV2.S vaccine in humans. | name mentioned* | literature_supp |
| 35837088 | Characterizing Features of Human Circulating B Cells Carrying CLL-Like Stereotyped Immunoglobulin Rearrangements. | name mentioned* | literature_supp |
| 36006380 | Humoral immunity to SARS-CoV-2 elicited by combination COVID-19 vaccination regimens. | name mentioned* | literature_supp |
| 36149398 | Memory B cell responses to Omicron subvariants after SARS-CoV-2 mRNA breakthrough infection in humans. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 36874132 | Characterization of clonal immunoglobulin heavy V-D-J gene rearrangements in Chinese patients with chronic lymphocytic leukemia: Clinical features and molecular profiles. | name mentioned* | literature_supp |
| 37368240 | Memory B cell development elicited by mRNA booster vaccinations in the elderly. | name mentioned* | literature_supp |
| 37533642 | TRAPnSeq allows high-throughput profiling of antigen-specific antibody-secreting cells. | name mentioned* | literature_supp |
| 38205245 | Comprehensive characterization and database construction of immune repertoire in the largest Chinese glioma cohort. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 38671086 | Hyper-N-glycosylated SEL1L3 as auto-antigenic B-cell receptor target of primary vitreoretinal lymphomas. | name mentioned* | literature_supp |
| 38961347 | Systematic characterization of immunoglobulin loci and deep sequencing of the expressed repertoire in the Atlantic cod (Gadus morhua). | name mentioned* | literature_supp |
| 39313500 | Large B-cell lymphomas with CCND1 rearrangement have different immunoglobulin gene breakpoints and genomic profile than mantle cell lymphoma. | name mentioned* | literature_supp |
| 39627383 | Novel polymorphic and copy number diversity in the antibody IGH locus of South African individuals. | name mentioned* | literature_supp |
| 39840032 | An allelic atlas of immunoglobulin heavy chain variable regions reveals antibody binding epitope preference resilient to SARS-CoV-2 mutation escape. | name mentioned* | literature_supp |
| 39873992 | Association of Specific Gene Mutations with Immunoglobulin Heavy-Chain Variable Region and Chromosomal Alterations in Chronic Lymphocytic Leukemia Patients in India. | name mentioned* | literature_supp |
| 40066131 | Characterization of Immunoglobulin Heavy Locus Rearrangements in Molecular Subtypes of Childhood B-Cell Precursor Acute Lymphoblastic Leukemia. | name mentioned* | literature_supp |
| 40386772 | B-cell immune repertoire sequencing in tobacco cigarette smoking, vaping, and chronic obstructive pulmonary disease in the COPDGene cohort. | name mentioned* | literature_supp |
| 40433552 | Antigen selection reflected in the subclonal architecture of the B-cell receptor immunoglobulin gene repertoire in splenic marginal zone lymphoma. | name mentioned* | literature_supp |
| 40588565 | Disease-specific U1 spliceosomal RNA mutations in mature B-cell neoplasms. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 40710355 | Pathogenesis of Graves' Disease Determined Using Single-Cell Sequencing with Thyroid Autoantigen Peptide Stimulation in B Cells. | name mentioned* | literature_supp |
| 41606257 | Allergen-specific human IgE isolated through an allergen-agnostic pipeline-understanding immune response and allergen recognition. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
| 42256548 | Genomic heterogeneity in primary cutaneous follicular center lymphomas reveals different clinicopathological subgroups. | name mentioned* | literature_supp |
| 42306064 | IGLV3-21R110 and ibrutinib treatment: Results from the double-blind, randomized, placebo-controlled GCLLSG CLL12 trial in early-stage CLL. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by HUSA, IMGT, KIARVA, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACC | HUSA IMGT | HUMAN-REXGWW |
| v_rs | CACAGTGAGGGGAAGTCAGTGTGAGCCCAGACGCAAACC | HUSA | HUMAN-RHXRLM |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGT | 46 + 11 nt | HUSA | HUMAN-L2VK2X |
| ATGGAATTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAGTGT | 46 + 11 nt | HUSA IMGT | HUMAN-LOOKYB |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VJ4ROGN32/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases