AIRBabel immunoglobulin and T-cell receptor allele sequences · leaders · RSSs

← back to search

HUMAN-VJUIT2YGZ

AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.

SpeciesHomo sapiens LocusIGH TypeV FunctionalNone Length303 nt

Earlier records of this allele i

IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.

RecordNameLengthRelation to this recordIMGT releases
HUMAN-VJ4K2C3FW IGHV3-65*01 300 nt contained in this record 2013-01-20–2019-03-01
HUMAN-VQ56KYENK IGHV3-65*01 301 nt contained in this record 2020-01-31–2022-01-17
SpeciesHomo sapiens (NCBITAXON:9606)
Locus / typeIGH / V
Functional iNone
Length303 nt
Protein UID iHUMAN-VP-A62QEQ (shared by alleles with the same V-REGION amino-acid sequence)

Allele names i

Every name below denotes this exact sequence (HUMAN-VJUIT2YGZ). None is canonical; they are labels, and the UID is the key.

NameSchemeSource(s)
IGHV3-65*01 IMGT IMGT

External records i

IMGT: IGHV3-65*01

Literature references 4 total · 1 sequence-in-paper · 3 name-mentioned* i

PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.

PMIDTitleEvidenceSource
35545447 Gene prediction in the immunoglobulin loci. sequence in paper literature_supp
34764956 Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. name mentioned* literature_supp
36328595 Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. name mentioned* literature_supp
38961347 Systematic characterization of immunoglobulin loci and deep sequencing of the expressed repertoire in the Atlantic cod (Gadus morhua). name mentioned* literature_supp

* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.

Contributed by IMGT. See Sources & citations for each source's version, citation and licence.

RSS i

Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.

PartSequenceSourceRSS UID
v_rsCACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACC IMGT HUMAN-R6AAZB

Leader

Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.

Leader (exon 1 + exon 2)SplitSourceLeader UID
ATGAAGTCTGGGCTGAGCCGGTTTTTCCTTGTTGCTATTTTAAAAGGTGTCCAGTGT 46 + 11 nt IMGT HUMAN-LNO6U4

Find similar alleles

Ranks coding alleles by normalized edit-distance identity. Also available at /api/sequences/HUMAN-VJUIT2YGZ/similar?min_identity=0.95&kind=nt.

Coding sequence (nt)

303 nt
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCCGTTAACTACTGCATGCAGTGGATCTGCCGGGCTCCAGGAAAGGGGCTGGAGTGGGTAGGTTTCACTAAAAACAAAACTAATCGTGGAACAACAGAATACGCCGCGTCTGTGAAAGGCAGATCCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTATACCAGAGA

Amino-acid sequence (V-REGION)

101 aa
EVQLVESGGGLVQPGGSLRLSCAASGFTFR*LLHAVDLPGSRKGAGVGRFH*KQN*SWNNRIRRVCERQIHHLKR*FQKHRLSANEQPENRGHGRVLLYQR

Translated here from the nucleotide sequence; no source published a protein for this allele. i