HUMAN-VOOT5ZFDD
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| HUMAN-VDVR3SYLP | IGHV1-2*04 | 294 nt | contained in this record | 2013-01-20 |
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 296 nt |
| Protein UID i | HUMAN-VP-UHEDEF (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (HUMAN-VOOT5ZFDD). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1-BEMW*01 | IgLabel | HUSA |
| IGHV1-2*04 | IMGT | IMGT, KIARVA, OGRDB |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| KF698733.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:KF698733 GenBank: GENBANK:KF698733.1 IMGT: IGHV1-2*04 OGRDB: IGHV1-2*04
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 23541343 | verified | ncbi_nucleotide | |
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | sequence in paper | literature_supp |
| 37076511 | Vaccination of SARS-CoV-2-infected individuals expands a broad range of clonally diverse affinity-matured B cell lineages. | sequence in paper | literature_supp |
| 37114042 | Adaptive immune receptor genotyping using the corecount program. | sequence in paper | literature_supp |
| 38643233 | An ancestral SARS-CoV-2 vaccine induces anti-Omicron variants antibodies by hypermutation. | sequence in paper | literature_supp |
| 22891273 | The coding genome of splenic marginal zone lymphoma: activation of NOTCH2 and other pathways regulating marginal zone development. | name mentioned* | literature_supp |
| 24032032 | The shape of the lymphocyte receptor repertoire: lessons from the B cell receptor. | name mentioned* | literature_supp |
| 24349473 | Whole exome sequencing identifies novel recurrently mutated genes in patients with splenic marginal zone lymphoma. | name mentioned* | literature_supp |
| 26146524 | New developments in the pathology of malignant lymphoma: a review of literature published from January 2015 to April 2015. | name mentioned* | literature_supp |
| 28018857 | Murine Models of Splenic Marginal Zone Lymphoma: A Role for Cav1? | name mentioned* | literature_supp |
| 28725665 | Data on haplotype-supported immunoglobulin germline gene inference. | name mentioned* | literature_supp |
| 28751561 | Exome sequencing identifies recurrent BCOR alterations and the absence of KLF2, TNFAIP3 and MYD88 mutations in splenic diffuse red pulp small B-cell lymphoma. | name mentioned* | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 29688540 | Selection and Neutral Mutations Drive Pervasive Mutability Losses in Long-Lived Anti-HIV B-Cell Lineages. | name mentioned* | literature_supp |
| 30598627 | Immunoglobulin Heavy Chain Gene Rearrangements in Patients with Gaucher Disease. | name mentioned* | literature_supp |
| 30697215 | VH1-69 Utilizing Antibodies Are Capable of Mediating Non-neutralizing Fc-Mediated Effector Functions Against the Transmitted/Founder gp120. | name mentioned* | literature_supp |
| 31320741 | Systematic Review of Somatic Mutations in Splenic Marginal Zone Lymphoma. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 31974198 | Genomic arrays identify high-risk chronic lymphocytic leukemia with genomic complexity: a multi-center study. | name mentioned* | literature_supp |
| 32083012 | B Cell Receptor Immunogenetics in B Cell Lymphomas: Immunoglobulin Genes as Key to Ontogeny and Clinical Decision Making. | name mentioned* | literature_supp |
| 32156260 | Tracing CLL-biased stereotyped immunoglobulin gene rearrangements in normal B cell subsets using a high-throughput immunogenetic approach. | name mentioned* | literature_supp |
| 32636395 | IgCaller for reconstructing immunoglobulin gene rearrangements and oncogenic translocations from whole-genome sequencing in lymphoid neoplasms. | name mentioned* | literature_supp |
| 33363034 | Role of Specific B-Cell Receptor Antigens in Lymphomagenesis. | name mentioned* | literature_supp |
| 33717051 | Poorly Expressed Alleles of Several Human Immunoglobulin Heavy Chain Variable Genes are Common in the Human Population. | name mentioned* | literature_supp |
| 33843586 | Distinct clonal evolution of B-cells in HIV controllers with neutralizing antibody breadth. | name mentioned* | literature_supp |
| 34126625 | Naturally enhanced neutralizing breadth against SARS-CoV-2 one year after infection. | name mentioned* | literature_supp |
| 34175903 | Immunoglobulin germline gene variation and its impact on human disease. | name mentioned* | literature_supp |
| 34242577 | In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. | name mentioned* | literature_supp |
| 34484220 | RAPID: A Rep-Seq Dataset Analysis Platform With an Integrated Antibody Database. | name mentioned* | literature_supp |
| 34489473 | Vaccine genetics of IGHV1-2 VRC01-class broadly neutralizing antibody precursor naïve human B cells. | name mentioned* | literature_supp |
| 34590593 | New Insights into the Biology and Diagnosis of Splenic Marginal Zone Lymphomas. | name mentioned* | literature_supp |
| 34614412 | mRNA vaccination of naive and COVID-19-recovered individuals elicits potent memory B cells that recognize SARS-CoV-2 variants. | name mentioned* | literature_supp |
| 34671351 | Computational Inference, Validation, and Analysis of 5'UTR-Leader Sequences of Alleles of Immunoglobulin Heavy Chain Variable Genes. | name mentioned* | literature_supp |
| 34765543 | The Hydropathy Index of the HCDR3 Region of the B-Cell Receptor Identifies Two Subgroups of IGHV-Mutated Chronic Lymphocytic Leukemia Patients With Distinct Outcome. | name mentioned* | literature_supp |
| 34785098 | Landscapes and dynamic diversifications of B-cell receptor repertoires in COVID-19 patients. | name mentioned* | literature_supp |
| 35397794 | A large-scale systematic survey reveals recurring molecular features of public antibody responses to SARS-CoV-2. | name mentioned* | literature_supp |
| 35447092 | Analysis of memory B cells identifies conserved neutralizing epitopes on the N-terminal domain of variant SARS-Cov-2 spike proteins. | name mentioned* | literature_supp |
| 35776090 | Antibody evolution to SARS-CoV-2 after single-dose Ad26.COV2.S vaccine in humans. | name mentioned* | literature_supp |
| 35837088 | Characterizing Features of Human Circulating B Cells Carrying CLL-Like Stereotyped Immunoglobulin Rearrangements. | name mentioned* | literature_supp |
| 36006380 | Humoral immunity to SARS-CoV-2 elicited by combination COVID-19 vaccination regimens. | name mentioned* | literature_supp |
| 36149398 | Memory B cell responses to Omicron subvariants after SARS-CoV-2 mRNA breakthrough infection in humans. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36353774 | High activation levels maintained in receptor-binding domain-specific memory B cells in people with severe coronavirus disease 2019. | name mentioned* | literature_supp |
| 36709153 | [Clinical analysis of 20 cases of small B lymphocyte proliferative disease with t (14;19) (q32;q13)]. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 37368240 | Memory B cell development elicited by mRNA booster vaccinations in the elderly. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 38467663 | Human immunoglobulin gene allelic variation impacts germline-targeting vaccine priming. | name mentioned* | literature_supp |
| 39280243 | The genomic and molecular landscape of splenic marginal zone lymphoma, biological and clinical implications. | name mentioned* | literature_supp |
| 39313500 | Large B-cell lymphomas with CCND1 rearrangement have different immunoglobulin gene breakpoints and genomic profile than mantle cell lymphoma. | name mentioned* | literature_supp |
| 39471431 | Epigenetic features support the diagnosis of B-cell prolymphocytic leukemia and identify 2 clinicobiological subtypes. | name mentioned* | literature_supp |
| 39627383 | Novel polymorphic and copy number diversity in the antibody IGH locus of South African individuals. | name mentioned* | literature_supp |
| 39840032 | An allelic atlas of immunoglobulin heavy chain variable regions reveals antibody binding epitope preference resilient to SARS-CoV-2 mutation escape. | name mentioned* | literature_supp |
| 40066131 | Characterization of Immunoglobulin Heavy Locus Rearrangements in Molecular Subtypes of Childhood B-Cell Precursor Acute Lymphoblastic Leukemia. | name mentioned* | literature_supp |
| 40433552 | Antigen selection reflected in the subclonal architecture of the B-cell receptor immunoglobulin gene repertoire in splenic marginal zone lymphoma. | name mentioned* | literature_supp |
| 40588565 | Disease-specific U1 spliceosomal RNA mutations in mature B-cell neoplasms. | name mentioned* | literature_supp |
| 40675999 | Optimizing human B cell repertoire analyses to interpret clinical data and design sequential HIV vaccines. | name mentioned* | literature_supp |
| 40789024 | Structural insights into VRC01-class bnAb precursors with diverse light chains elicited in the IAVI G001 human vaccine trial. | name mentioned* | literature_supp |
| 41606257 | Allergen-specific human IgE isolated through an allergen-agnostic pipeline-understanding immune response and allergen recognition. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 41803327 | IFN-gene signatures in B cells following influenza A and B virus infection and influenza vaccination. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by HUSA, IMGT, KIARVA, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTGAAAACCCACATCCTGAGGGTGTCAGAAACC | HUSA IMGT | HUMAN-RP6NFN |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCCACAGGAGCCCACTCC | 46 + 11 nt | HUSA IMGT | HUMAN-L3DVSR |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VOOT5ZFDD/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases