MOUSE-DVA65AYDQ
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHD6-2*01: a Mus musculus IGH D allele sequence, 29 nt, functional. The nucleotide sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| MOUSE-DE772DGJJ | IGHD6-2*01 | 27 nt | contained in this record | 2013-01-20–2015-03-19 |
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | IGH / D |
| Functional i | True |
| Length | 29 nt |
Coding sequence (nt)
Name history i: formerly IGHD6-2*02 (to 2013-01-20); re-cut from IGHD6-2*01 (27 nt);
Allele names i
Every name below denotes this exact sequence (MOUSE-DVA65AYDQ). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHD6-2*01 | IMGT | IMGT |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGHD6-2*02 | 2013-01-20 |
External records i
GenBank: GENBANK:AC073553 IMGT: IGHD6-2*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| d_rs_3 | CACAATGTCTTGTGACCTTACAAGAAAG | IMGT | MOUSE-RI66IU |
| d_rs_5 | CCTCTATAACAGTACCCATGGTGAATTC | IMGT | MOUSE-R4QXS2 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Restricted for D genes: only 29 nt alleles are compared, position by position. D genes are too short (8–148 nt, median 19 nt) for edit-distance scores to be interpreted reliably; the metric can open gaps that inflate identity, and at 19 nt the 0.75 identity floor is about four mismatches. A D allele is therefore compared only against D alleles of exactly the same length, scored position by position. Alleles of the same gene that differ in length are not ranked here; separating those requires a multiple-sequence alignment, not a pairwise score.
Ranks D alleles of the same length,
by positional identity.
Also available at /api/sequences/MOUSE-DVA65AYDQ/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases