MOUSE-V2YYMOVWL
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 294 nt |
| Protein UID i | MOUSE-VP-4SFOQA (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (MOUSE-V2YYMOVWL). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1-69*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AC073939.6 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:AC073939 GenBank: GENBANK:AC073939.6 IMGT: IGHV1-69*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 22216179 | Biased use of the IGHV4 family and evidence for antigen selection in Chlamydophila psittaci-negative ocular adnexal extranodal marginal zone lymphomas. | name mentioned* | literature_supp |
| 25392411 | PyIgClassify: a database of antibody CDR structural classifications. | name mentioned* | literature_supp |
| 27857134 | Germline-encoded neutralization of a Staphylococcus aureus virulence factor by the human antibody repertoire. | name mentioned* | literature_supp |
| 28125682 | The Number of Overlapping AID Hotspots in Germline IGHV Genes Is Inversely Correlated with Mutation Frequency in Chronic Lymphocytic Leukemia. | name mentioned* | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 30530648 | Virus-inclusive single-cell RNA sequencing reveals the molecular signature of progression to severe dengue. | name mentioned* | literature_supp |
| 30598627 | Immunoglobulin Heavy Chain Gene Rearrangements in Patients with Gaucher Disease. | name mentioned* | literature_supp |
| 30697215 | VH1-69 Utilizing Antibodies Are Capable of Mediating Non-neutralizing Fc-Mediated Effector Functions Against the Transmitted/Founder gp120. | name mentioned* | literature_supp |
| 30808649 | Worldwide genetic variation of the IGHV and TRBV immune receptor gene families in humans. | name mentioned* | literature_supp |
| 31816964 | Antibody Structure and Function: The Basis for Engineering Therapeutics. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 31974198 | Genomic arrays identify high-risk chronic lymphocytic leukemia with genomic complexity: a multi-center study. | name mentioned* | literature_supp |
| 32156260 | Tracing CLL-biased stereotyped immunoglobulin gene rearrangements in normal B cell subsets using a high-throughput immunogenetic approach. | name mentioned* | literature_supp |
| 32365177 | Polymorphisms in human immunoglobulin heavy chain variable genes and their upstream regions. | name mentioned* | literature_supp |
| 32425948 | AID Overlapping and Polη Hotspots Are Key Features of Evolutionary Variation Within the Human Antibody Heavy Chain (IGHV) Genes. | name mentioned* | literature_supp |
| 32636395 | IgCaller for reconstructing immunoglobulin gene rearrangements and oncogenic translocations from whole-genome sequencing in lymphoid neoplasms. | name mentioned* | literature_supp |
| 33004832 | Chronic lymphocytic leukemia-associated paraneoplastic pemphigus: potential cause and therapeutic strategies. | name mentioned* | literature_supp |
| 33180672 | Hiding in plain sight: structure and sequence analysis reveals the importance of the antibody DE loop for antibody-antigen binding. | name mentioned* | literature_supp |
| 33661303 | Plasmodium falciparum-specific IgM B cells dominate in children, expand with malaria, and produce functional IgM. | name mentioned* | literature_supp |
| 33717051 | Poorly Expressed Alleles of Several Human Immunoglobulin Heavy Chain Variable Genes are Common in the Human Population. | name mentioned* | literature_supp |
| 33843586 | Distinct clonal evolution of B-cells in HIV controllers with neutralizing antibody breadth. | name mentioned* | literature_supp |
| 34104872 | Potent germline-like monoclonal antibodies: rapid identification of promising candidates for antibody-based antiviral therapy. | name mentioned* | literature_supp |
| 34126625 | Naturally enhanced neutralizing breadth against SARS-CoV-2 one year after infection. | name mentioned* | literature_supp |
| 34242577 | In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. | name mentioned* | literature_supp |
| 34614412 | mRNA vaccination of naive and COVID-19-recovered individuals elicits potent memory B cells that recognize SARS-CoV-2 variants. | name mentioned* | literature_supp |
| 34765543 | The Hydropathy Index of the HCDR3 Region of the B-Cell Receptor Identifies Two Subgroups of IGHV-Mutated Chronic Lymphocytic Leukemia Patients With Distinct Outcome. | name mentioned* | literature_supp |
| 34788600 | Immunizations with diverse sarbecovirus receptor-binding domains elicit SARS-CoV-2 neutralizing antibodies against a conserved site of vulnerability. | name mentioned* | literature_supp |
| 34815307 | Individualized VDJ recombination predisposes the available Ig sequence space. | name mentioned* | literature_supp |
| 35108220 | Ultrapotent neutralizing antibodies against SARS-CoV-2 with a high degree of mutation resistance. | name mentioned* | literature_supp |
| 35347236 | Mouse and human antibodies bind HLA-E-leader peptide complexes and enhance NK cell cytotoxicity. | name mentioned* | literature_supp |
| 35447092 | Analysis of memory B cells identifies conserved neutralizing epitopes on the N-terminal domain of variant SARS-Cov-2 spike proteins. | name mentioned* | literature_supp |
| 35592326 | Pandemic, Epidemic, Endemic: B Cell Repertoire Analysis Reveals Unique Anti-Viral Responses to SARS-CoV-2, Ebola and Respiratory Syncytial Virus. | name mentioned* | literature_supp |
| 35720344 | A BALB/c IGHV Reference Set, Defined by Haplotype Analysis of Long-Read VDJ-C Sequences From F1 (BALB/c x C57BL/6) Mice. | name mentioned* | literature_supp |
| 35776090 | Antibody evolution to SARS-CoV-2 after single-dose Ad26.COV2.S vaccine in humans. | name mentioned* | literature_supp |
| 35837088 | Characterizing Features of Human Circulating B Cells Carrying CLL-Like Stereotyped Immunoglobulin Rearrangements. | name mentioned* | literature_supp |
| 36006380 | Humoral immunity to SARS-CoV-2 elicited by combination COVID-19 vaccination regimens. | name mentioned* | literature_supp |
| 36149398 | Memory B cell responses to Omicron subvariants after SARS-CoV-2 mRNA breakthrough infection in humans. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 36591518 | Evidence of somatic hypermutation in the antigen binding sites of patients with CLL harboring IGHV genes with 100% germline identity. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 36874132 | Characterization of clonal immunoglobulin heavy V-D-J gene rearrangements in Chinese patients with chronic lymphocytic leukemia: Clinical features and molecular profiles. | name mentioned* | literature_supp |
| 37368240 | Memory B cell development elicited by mRNA booster vaccinations in the elderly. | name mentioned* | literature_supp |
| 37624867 | Germline-encoded specificities and the predictability of the B cell response. | name mentioned* | literature_supp |
| 38264661 | Effect of BAFF blockade on the B cell receptor repertoire and transcriptome in a mouse model of systemic lupus erythematosus. | name mentioned* | literature_supp |
| 38406579 | AIRR-C IG Reference Sets: curated sets of immunoglobulin heavy and light chain germline genes. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
| 39840032 | An allelic atlas of immunoglobulin heavy chain variable regions reveals antibody binding epitope preference resilient to SARS-CoV-2 mutation escape. | name mentioned* | literature_supp |
| 39873992 | Association of Specific Gene Mutations with Immunoglobulin Heavy-Chain Variable Region and Chromosomal Alterations in Chronic Lymphocytic Leukemia Patients in India. | name mentioned* | literature_supp |
| 40066131 | Characterization of Immunoglobulin Heavy Locus Rearrangements in Molecular Subtypes of Childhood B-Cell Precursor Acute Lymphoblastic Leukemia. | name mentioned* | literature_supp |
| 40588565 | Disease-specific U1 spliceosomal RNA mutations in mature B-cell neoplasms. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 40750588 | Structural basis of broad protection against influenza virus by human antibodies targeting the neuraminidase active site via a recurring motif in CDR H3. | name mentioned* | literature_supp |
| 41077783 | Rapid immunization and antibody redesign platform discovers broadly neutralizing antibodies against non-immunized SARS-CoV-2 variant. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
| 41606257 | Allergen-specific human IgE isolated through an allergen-agnostic pipeline-understanding immune response and allergen recognition. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 41803327 | IFN-gene signatures in B cells following influenza A and B virus infection and influenza vaccination. | name mentioned* | literature_supp |
| 41961592 | Naturally self-reactive B cells are poised to cross the selection barrier into autoimmune germinal centers. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
| 42256548 | Genomic heterogeneity in primary cutaneous follicular center lymphomas reveals different clinicopathological subgroups. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAACC | IMGT | MOUSE-RLLW2P |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGGATGGAGCTGTATCATCCTCTTCTTGGTATCAACAGCTACAGGTGTCCACTCC | 46 + 11 nt | IMGT | MOUSE-LNW6ZC |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/MOUSE-V2YYMOVWL/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases