MOUSE-VF7QXBQJJ
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| MOUSE-V3NOCIPWV | IGHV1-69*03 | 252 nt | contained in this record | 2013-01-20–2024-01-07 |
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 294 nt |
| Protein UID i | MOUSE-VP-2GF4IC (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (MOUSE-VF7QXBQJJ). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1-69*03 | IMGT | IMGT |
External records i
GenBank: GENBANK:IMGT000188 IMGT: IGHV1-69*03
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 32636395 | IgCaller for reconstructing immunoglobulin gene rearrangements and oncogenic translocations from whole-genome sequencing in lymphoid neoplasms. | name mentioned* | literature_supp |
| 34671351 | Computational Inference, Validation, and Analysis of 5'UTR-Leader Sequences of Alleles of Immunoglobulin Heavy Chain Variable Genes. | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
| 40588565 | Disease-specific U1 spliceosomal RNA mutations in mature B-cell neoplasms. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAACC | IMGT | MOUSE-RLLW2P |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGGATGGAGCTGTATCATCCTCTTCTTGGTATCAACAGCTACAGGTGTCCACTCC | 46 + 11 nt | IMGT | MOUSE-LNW6ZC |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/MOUSE-VF7QXBQJJ/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases