ORANGSUM-VIZHPKDUU
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Pongo abelii (NCBITAXON:9601) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 295 nt |
| Protein UID i | ORANGSUM-VP-7ZQEN2 (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (ORANGSUM-VIZHPKDUU). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1-4*01 | IMGT | IMGT |
External records i
IMGT: IGHV1-4*01
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 40205052 | Complete sequencing of ape genomes. | sequence in paper | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 34813501 | B cell receptor isotypes differentially associate with cell signaling, kinetics, and outcome in chronic lymphocytic leukemia. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 36604758 | Bacteroides-derived isovaleric acid enhances mucosal immunity by facilitating intestinal IgA response in broilers. | name mentioned* | literature_supp |
| 37938344 | Role of affinity in plasma cell development in the germinal center light zone. | name mentioned* | literature_supp |
| 38567069 | Diversification of immunoglobulin genes by gene conversion in the domestic chicken (Gallus gallus domesticus). | name mentioned* | literature_supp |
| 39127707 | Covalent penicillin-protein conjugates elicit anti-drug antibodies that are clonally and functionally restricted. | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
| 41021799 | Molecular divergence and convergence of mammalian antibody responses to the influenza virus hemagglutinin stem. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
| 41873331 | Porcine influenza mAbs to H3, H5, and H7 hemagglutinins recognize H3 egg adapted site and target the HA stem. | name mentioned* | literature_supp |
| 41941497 | Pigs lacking Natural Killer T cells have altered cellular responses to influenza. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTGAAAACCCACATCCTGAGAGTGTCAGAAACC | IMGT | ORANGSUM-RNTBEN |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCTACAGGTGCCCACTCC | 46 + 11 nt | IMGT | ORANGSUM-LMJTFN |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/ORANGSUM-VIZHPKDUU/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases