ORANGSUM-VR4M4L5PC
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRGV5*02, TRGV5D*01, TRGV5N*01: a Pongo abelii TRG V allele sequence, 300 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Pongo abelii (NCBITAXON:9601) |
|---|---|
| Locus / type | TRG / V |
| Functional i | True |
| Length | 300 nt |
| Protein UID i | ORANGSUM-VP-VSROF2 (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (ORANGSUM-VR4M4L5PC). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 3 different allele designations: TRGV5*02, TRGV5D*01, TRGV5N*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| TRGV5*02 | IMGT | IMGT |
| TRGV5D*01 | IMGT | IMGT |
| TRGV5N*01 | IMGT | IMGT |
External records i
IMGT: TRGV5*02
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 40205052 | Complete sequencing of ape genomes. | sequence in paper | literature_supp |
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGATTCAGACCTGCCCTACACCACACTGAAAATC | IMGT | ORANGSUM-RQCVZW |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGCGGTGGGCCCTAGCGGTGCTTCTAGCTTTCCTGTCTCCTGCCAGTCAGAAA | 43 + 11 nt | IMGT | ORANGSUM-LWZJQK |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/ORANGSUM-VR4M4L5PC/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases