RHESUS-VDU4PB2BJ
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV1-LJ3W*01_i0tttatcagtgagtgga_7atcc10_c14t_t19a_t21a_t25g_t27c_c31t_34ataa37_a39g_g43t_t44c_g49a_a50g_c51g_55catt58_c60a_a64t_c65t_t66g_68atcaa72_g77t_79gcctttg85_t87c_106catggag112_t114a_t115a_a117c_t124a_a125t_t126c_c130a_a131t_a133t_c136-_c137t_a138t_a142c_a144g_146gatt149_a151g_a152c_g153a_156tgat159_c162a_a164c_g166c_168catc171_c195t_c197a_t199g_a203c_a204c_206aaaat210_t220g_a222c_a223t_t226c_a240-_247-----------------------269_c276t_a277g_c279g_g282a_g289-_a291g_a293g_t294c_t296g_g298a_c302a_t303a_a305t_312atgc315_a317t_t319a_a323g_c324g_a325g_t327a_329ccaaat334: a Macaca mulatta IGK V allele sequence, 276 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 276 nt |
| Protein UID i | RHESUS-VP-IWCBEV (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VDU4PB2BJ). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV1-LJ3W*01_i0tttatcagtgagtgga_7atcc10_c14t_t19a_t21a_t25g_t27c_c31t_34ataa37_a39g_g43t_t44c_g49a_a50g_c51g_55catt58_c60a_a64t_c65t_t66g_68atcaa72_g77t_79gcctttg85_t87c_106catggag112_t114a_t115a_a117c_t124a_a125t_t126c_c130a_a131t_a133t_c136-_c137t_a138t_a142c_a144g_146gatt149_a151g_a152c_g153a_156tgat159_c162a_a164c_g166c_168catc171_c195t_c197a_t199g_a203c_a204c_206aaaat210_t220g_a222c_a223t_t226c_a240-_247-----------------------269_c276t_a277g_c279g_g282a_g289-_a291g_a293g_t294c_t296g_g298a_c302a_t303a_a305t_312atgc315_a317t_t319a_a323g_c324g_a325g_t327a_329ccaaat334 | VDJbase | MUSA |
Contributed by MUSA. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGCTGTAGCCTGTGCACAAACC | MUSA | RHESUS-R3RWQM |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VDU4PB2BJ/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases