RHESUS-VDYSWQXG2
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV2-54DC*05_a2c_t5c_a10c_c15t_a19c_c25t_t26c_28ctca31_c34t_c36t_c39g_a40g_c43g_c44t_t45g_g51c_c52a_c53a_c56t_c57a_g71a_t73g_t75c_g81c_g83a_c84t_t87c_c88a_g90c_t96g_a106g_c110t_t114c_g118a_t120c_t121g_g122c_a125t_t128a_g129a_g139c_g140a_g144a_a150t_g152a_g153a_t155c_c156g_a167t_a168g_t171g_c195a_t198c_c199a_a204t_g208-_a221c_a223c_g225c_t226g_a249t_g250c_c252g_c254g_a255g_t258g_g267c_a269c_a274c_g275c_a279t_c286t_c287a_t288g_a290g_g291a_299cata302_t306c_a308t_c309t_c312t_t314a_318gcac321_a324t_a325c_327ttgggaaccta337: a Macaca mulatta IGK V allele sequence, 303 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 303 nt |
| Protein UID i | RHESUS-VP-K47RQQ (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VDYSWQXG2). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV2-54DC*05_a2c_t5c_a10c_c15t_a19c_c25t_t26c_28ctca31_c34t_c36t_c39g_a40g_c43g_c44t_t45g_g51c_c52a_c53a_c56t_c57a_g71a_t73g_t75c_g81c_g83a_c84t_t87c_c88a_g90c_t96g_a106g_c110t_t114c_g118a_t120c_t121g_g122c_a125t_t128a_g129a_g139c_g140a_g144a_a150t_g152a_g153a_t155c_c156g_a167t_a168g_t171g_c195a_t198c_c199a_a204t_g208-_a221c_a223c_g225c_t226g_a249t_g250c_c252g_c254g_a255g_t258g_g267c_a269c_a274c_g275c_a279t_c286t_c287a_t288g_a290g_g291a_299cata302_t306c_a308t_c309t_c312t_t314a_318gcac321_a324t_a325c_327ttgggaaccta337 | VDJbase | MUSA |
Contributed by MUSA. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | AACAGTGTAACGGTTCTAAGCATACACC | MUSA | RHESUS-RVTPIZ |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VDYSWQXG2/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases