RHESUS-VF2JWCNI6
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| RHESUS-VSHLO2NLN | IGLV3-16*01 | 288 nt | bases differ | 2015-03-19–2020-01-31 |
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / V |
| Functional i | False |
| Length | 290 nt |
| Protein UID i | RHESUS-VP-7BMH6A (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-VF2JWCNI6). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV3-16*01 | IgLabel | MUSA |
| IGLV3-16*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| BK063717.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:BK063717 GenBank: GENBANK:BK063717.1 IMGT: IGLV3-16*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 34875068 | verified | ncbi_nucleotide | |
| 35335026 | IMGT® Biocuration and Analysis of the Rhesus Monkey IG Loci. | verified | ncbi_nucleotide |
| 25338678 | Sequencing of the human IG light chain loci from a hydatidiform mole BAC library reveals locus-specific signatures of genetic diversity. | name mentioned* | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 34587480 | Paired heavy- and light-chain signatures contribute to potent SARS-CoV-2 neutralization in public antibody responses. | name mentioned* | literature_supp |
| 35776090 | Antibody evolution to SARS-CoV-2 after single-dose Ad26.COV2.S vaccine in humans. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 38707998 | Maintenance of caecal homeostasis by diverse adaptive immune cells in the rhesus macaque. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, MUSA, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGACACTGGCAGATGGGGAAGTGAGACACAAACC | IMGT | RHESUS-R5DUSV |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATAGCCTGGATTCCTCTCCTACTCCCCATCCTCACTTTCTGCACAGGCTCTGCAGCC | 46 + 11 nt | IMGT | RHESUS-LLXTHF |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VF2JWCNI6/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases