AIRBabel immunoglobulin and T-cell receptor allele sequences · leaders · RSSs

← back to search

RHESUS-VSHLO2NLN

AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.

StatusArchived · seen 2015-03-19 → 2020-01-31 SpeciesMacaca mulatta LocusIGL TypeV FunctionalNone Length288 nt RecordSuperseded

A newer source record exists for this allele designation. IGLV3-16*01 is still published by IMGT as RHESUS-VF2JWCNI6, 290 nt, whose bases differ from this one. This is the earlier record (288 nt, current in IMGT releases 2015-03-19–2020-01-31). The allele was not renamed and it was not withdrawn: IMGT changed the published sequence extent associated with this designation. Both extents are kept because a sequence is identified by its bases, so a change in extent is a different sequence.

SpeciesMacaca mulatta (NCBITAXON:9544)
Locus / typeIGL / V
Functional iNone
Length288 nt
Protein UID iRHESUS-VP-JOXEAW (shared by alleles with the same V-REGION amino-acid sequence)

Allele names i

None.

Former IMGT names i

Former nameLast seen in IMGT release
IGLV3-16*012015-03-19

Contributed by IMGT. See Sources & citations for each source's version, citation and licence.

Find similar alleles

Ranks coding alleles by normalized edit-distance identity. Also available at /api/sequences/RHESUS-VSHLO2NLN/similar?min_identity=0.95&kind=nt.

Coding sequence (nt)

288 nt
TCCGATGAGCTGACACAGCAGTCATTGCTGTCAGTGTCCCTGAGACGGATGGCCAGGATCACCAGTTGTGGAAATACAGTGGGGAAAATTATGATCATTAGTACCAGCTAAAGCCAGGCCAGATCACTGTGCTGGCCCTACATACAGATCACTCCCAGTCCTCGGGGTCTCTTAGTGATTATCGGGGTCTAGATCAGATCAGCCAAGACAGTCACCCTGACCATGAGTGGGACCCAGCCGAGGATGAGGCTATTAATGTCAACTGAGTGGCAGCAGTAGTACTCAATC

Amino-acid sequence (V-REGION)

96 aa
SDELTQQSLLSVSLRRMARITSCGNTVGKIMIISTS*SQARSLCWPYIQITPSPRGLLVIIGV*IRSAKTVTLTMSGTQPRMRLLMSTEWQQ*YSI

Translated here from the nucleotide sequence; no source published a protein for this allele. i