RHESUS-VHRLBUL6S
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGLV1-123*02, IGLV18-63QE*06_g7a_g15t_c20t_c38g_c42a_c65t_g75a_t82a_c83a_c87t_a88g_g91a_g92c_g93a_104atac107_t112c_a113c_c118a_g120c_g132t_t135c_141-ggt144_c146t_c147g_c149t_c150t_a152g_c156g_t163c_a164t_a167g_a168t_a169g_a200g_a202g_g204c_c205t_g216a_t219c_t220c_t228c_c229t_i231t_t252c_c254a_c257t_a279g_c283t_a284g_t286c_g292a_t307c_c309t_c318t_t321g_c324t_g333a_a334g_g335a_340ta341: a Macaca mulatta IGL V allele sequence, 299 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / V |
| Functional i | False |
| Length | 299 nt |
| Protein UID i | RHESUS-VP-GBSELP (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: formerly IGLV1-1*01 (to 2019-03-01);
Allele names i
Every name below denotes this exact sequence (RHESUS-VHRLBUL6S). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGLV1-123*02, IGLV18-63QE*06_g7a_g15t_c20t_c38g_c42a_c65t_g75a_t82a_c83a_c87t_a88g_g91a_g92c_g93a_104atac107_t112c_a113c_c118a_g120c_g132t_t135c_141-ggt144_c146t_c147g_c149t_c150t_a152g_c156g_t163c_a164t_a167g_a168t_a169g_a200g_a202g_g204c_c205t_g216a_t219c_t220c_t228c_c229t_i231t_t252c_c254a_c257t_a279g_c283t_a284g_t286c_g292a_t307c_c309t_c318t_t321g_c324t_g333a_a334g_g335a_340ta341. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV1-123*02 | IMGT | IMGT |
| IGLV18-63QE*06_g7a_g15t_c20t_c38g_c42a_c65t_g75a_t82a_c83a_c87t_a88g_g91a_g92c_g93a_104atac107_t112c_a113c_c118a_g120c_g132t_t135c_141-ggt144_c146t_c147g_c149t_c150t_a152g_c156g_t163c_a164t_a167g_a168t_a169g_a200g_a202g_g204c_c205t_g216a_t219c_t220c_t228c_c229t_i231t_t252c_c254a_c257t_a279g_c283t_a284g_t286c_g292a_t307c_c309t_c318t_t321g_c324t_g333a_a334g_g335a_340ta341 | VDJbase | MUSA |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGLV1-1*01 | 2019-03-01 |
External records i
IMGT: IGLV1-123*02
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 38567069 | Diversification of immunoglobulin genes by gene conversion in the domestic chicken (Gallus gallus domesticus). | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, MUSA. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGCTCCGGGCCGGTGAGAAAGTGAGACAAAAACA | IMGT MUSA | RHESUS-RUYABU |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGTGTGGCCCCCTCTCCTTGCCCTCCCTATTTACTGCACAGATAACTGGTCCTGAGCT | 49 + 11 nt | IMGT | RHESUS-LJZEZV |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VHRLBUL6S/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases