RHESUS-VJ5WEYRFH
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV2-BIYZ*01_g1a_a2c_g4a_t5c_a10c_t19c_c25t_t26c_t28c_c29t_c31a_c34t_c36t_a37g_c39g_a40g_c43g_c44t_t45g_c49g_g51c_c52a_c53a_c56t_c57a_g71a_t73g_t75c_a81c_g83a_c84t_t87c_g88a_a90c_c93t_t96g_a106g_c110t_t120c_t121g_g122c_a126c_g129a_g139c_g140a_c145t_150tcaa153_g155c_c156g_a159g_t162c_c166a_a167t_t171g_t193a_t195a_c199a_c204-_t207c_g208t_a221c_a223c_a225c_t226g_c231t_g247t_a249t_g250c_c254g_a255g_t258g_g267c_a269c_a274c_g275c_a279t_g286t_c287a_t288g_a290g_g291a_g299c_g301t_t302a_t306c_a308t_c309t_c312t_t314a_c316t_318gcac321_a324t_c331g_c332a_t333a_336ta337: a Macaca mulatta IGK V allele sequence, 303 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 303 nt |
| Protein UID i | RHESUS-VP-36KPU4 (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VJ5WEYRFH). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV2-BIYZ*01_g1a_a2c_g4a_t5c_a10c_t19c_c25t_t26c_t28c_c29t_c31a_c34t_c36t_a37g_c39g_a40g_c43g_c44t_t45g_c49g_g51c_c52a_c53a_c56t_c57a_g71a_t73g_t75c_a81c_g83a_c84t_t87c_g88a_a90c_c93t_t96g_a106g_c110t_t120c_t121g_g122c_a126c_g129a_g139c_g140a_c145t_150tcaa153_g155c_c156g_a159g_t162c_c166a_a167t_t171g_t193a_t195a_c199a_c204-_t207c_g208t_a221c_a223c_a225c_t226g_c231t_g247t_a249t_g250c_c254g_a255g_t258g_g267c_a269c_a274c_g275c_a279t_g286t_c287a_t288g_a290g_g291a_g299c_g301t_t302a_t306c_a308t_c309t_c312t_t314a_c316t_318gcac321_a324t_c331g_c332a_t333a_336ta337 | VDJbase | MUSA |
Contributed by MUSA. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | AACAGTGTAACGGTTCTAAGCATACACC | MUSA | RHESUS-RVTPIZ |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VJ5WEYRFH/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases